Z-Hunt

From Christoph's Personal Wiki

ZHUNT (aka Z-Hunt or ZHunt) is an algorithm for predicting the propensity of DNA to flip from the B-form to the Z-form. The original algorithm was written by Dr. P. Shing Ho in 1986[1] and was later developed by Tracy Camp, P. Christoph Champ, Sandor Maurice, and Jeffrey M. Vargason for genome-wide mapping of Z-DNA (with P. Shing Ho as the principal investigator)[2]. ZHUNT is available for use Online at ZHunt Online.

Contents

Introduction

Description

ZHUNT was constructed as a program to predict the formation of Z-DNA for any sequence of n dinucleotides. A branching algorithm is used to find the minimum total propagation energy for the sequence to assign the ΔG° values to calculate the propagation term (S) for each dinucleotide in the simple set of nested DO LOOPS for the product and summation terms of Q and <ΔTw> as the program walks through a sequence. The complete output from the includes the "best" stretch of Z-DNA dinucleotides in the sequence, the anti-syn assignments for the dinucleotides in this stretch, the <ΔTw> and the ΔLkm for the stretch—the lower the ΔLkm, the higher the potential that the sequence will form Z-DNA.

In order for the ΔLkm values to be useful as a predictive tool, they are converted to propensities for forming Z-DNA relative to random sequences. Thus, the ΔLkm value is compared to those for a set of randomly generated sequences to calculate a propensity (originally called a Z-score[1], but now referred to a PZ[2]), which reflects the propensity for the sequence to form Z-DNA. PZ for a particular sequence is defined as the number of random sequences that one must search in order to find one that has a similar or higher propensity to form Z-DNA, and has units of base pairs (bp).[3]

Terms

ΔLkm 
linking number
Tw
change in helical twist
ΔWr 
change in writhe = ΔWr = ΔLkm – <ΔTw>
ΔG° 
overall energy associated with the transition from B-DNA to Z-DNA; ΔG° = K(ΔLkm – ΔTwm)2
K 
K = 1100RT/N, for N number of base pairs in the DNA plasmid (see: [3] for description)
Q 
partition function
Image:Partition function.png
for propagation of Z-DNA through n number of dinucleotides, and 0.179 is the ΔTw for each dinucleotide and 0.4 is the ΔTw of the two B–Z junctions.
Tw
change in overall helical twist

Z-score

Note: The following table is a list of test sequences with their corresponding conformational assignments and Z-scores (now called "PZ" scores). This "Z-score" should not be confused with the statistical "Standard score". Here, it describes the propensity of a given sequence to adopt the left-handed form of DNA; it is simply a probability score.

Sequence/conf. assignments  | Z-score
----------------------------|------------
CGCGCGCGCGCGCGCGCGCGCGCG    | 2 x 10e+11
ASASASASASASASASASASASAS    |
                            |
CGCGCGCGCGCG                | 4 x 10e+07
ASASASASASAS                |
                            |
CACACACACACACACACACACACA    | 2 x 10e+05
ASASASASASASASASASASASAS    |
                            |
CACACACACACA                | 2 x 10e+04
ASASASASASAS                |
                            |
CGCGCGCGCGCG GCGCGCGCGCGC   | 2 x 10e+08
ASASASASASAS SASASASASASA   |
                            |
CGCGCG GCGCGC CGCGCG GCGCGC | 7 x 10e+04
ASASAS SASASA ASASAS SASASA |
                            |
 *   *   *   *   *   *      |
CCCGCCCGCCCGCCCGCCCGCCCG    | 8 x 10e+04
ASASASASASASASASASASASAS    |
                            |
  *   *   *   *   *   *     |
CAGGCAGGCAGGCAGGCAGGCAGG    | 1 x 10e+03
ASASASASASASASASASASASAS    |
                            |
 * * * * * * * * * * * *    |
CCCCCCCCCCCCCCCCCCCCCCCC    | 52
ASASASASASASASASASASASAS    |
                            |
ATATATATATATATATATATATAT    | 38
SASASASASASASASASASASASA    |
                            |
AAAAAAAAAAAAAAAAAAAAAAAA    | 3 x 10e-07
ASASASASASASASASASASASAS    |
Various test sequences are shown with their corresponding Z-score as assigned by Z-hunt [version 1]. Z-scores are defined as the number of random base pairs that must be scanned, on average, to find a sequence with equal or better Z-forming capacity relative to the sequence in question. The conformation selected by Z-hunt for each nucleotide (A for anti and S for syn) are indicated below each sequence. Bases which deviate from perfect purine-pyrimidine alternation are designated by dots above that nucleotide. Discontinuities in the conformational phases produced by Z-Z junctions are represented by gaps separating the sequence.[4]

Keywords and abbreviations

  • Keywords: Z-DNA; Nuclear factor I; Transcription regulation; Thermogenomics
  • Abbreviations: ZDR, potential Z-DNA regions; NFI, nuclear factor I; CSF, colony stimulating factor

See also

References

  1. 1.0 1.1 Ho PS, Ellison MJ, Quigley GJ, Rich A (1986). A computer aided thermodynamic approach for predicting the formation of Z-DNA in naturally occurring sequences. EMBO J, 5(10):2737-2744.
  2. 2.0 2.1 Champ PC, Maurice S, Vargason JM, Camp T, Ho PS (2004). Distributions of Z-DNA and nuclear factor I in human chromosome 22: a model for coupled transcriptional regulation. Nucleic Acids Research, 32(22):6501-6510.
  3. 3.0 3.1 Ho PS (2008). "Thermogenomics: Thermodynamic-based approaches to genomic analyses of DNA structure". Methods, [Epub ahead of print]. PMID: 18848994. DOI:10.1016/j.ymeth.2008.09.007
  4. Ho PS, Ellison MJ, Quigley GJ, Rich A (1986). A computer aided thermodynamic approach for predicting the formation of Z-DNA in naturally occurring sequences. EMBO J, 5(10):2737-2744.

Further reading

  • Ho PS (2008). "Thermogenomics: Thermodynamic-based approaches to genomic analyses of DNA structure". Methods, [Epub ahead of print]. PMID: 18848994. DOI:10.1016/j.ymeth.2008.09.007
  • Ho PS (1994). The non-B-DNA structure of d(CA/TG)n does not differ from that of Z-DNA. Proc Natl Acad Sci USA, 91(20):9549-9553.
  • Schroth GP, Chou PJ, Ho PS (1992). Mapping Z-DNA in the human genome. Computer-aided mapping reveals a nonrandom distribution of potential Z-DNA-forming sequences in human genes. J Biol Chem, 267(17):11846-55.

External links

  • ZHunt Online Server (website currently offline) — front end by Sandor Maurice; back end by Sandor Maurice and P. Christoph Champ.
  • make-na server — create custom DNA structures (in PDB format)
Personal tools