Blastall - Revision history

Christoph at 00:45, 17 August 2007

2007-08-17T00:45:41Z

Christoph at 08:35, 29 December 2006

2006-12-29T08:35:42Z

Christoph at 08:27, 29 December 2006

2006-12-29T08:27:48Z

Show changes

Christoph: /* External links */

2006-10-18T02:19:29Z

‎External links

Christoph: Started article

2006-01-23T23:56:15Z

Started article

New page

'''Blastall''' allows the use of all BLAST programs (<tt>blastn</tt>, <tt>blastp</tt>, <tt>blastx</tt>, <tt>tblastx</tt>, and <tt>tblastn</tt>).

== Introduction ==

Blastall may be used to perform all five flavuors of blast comparison. One may obtain the <tt>blastall</tt> options by executing "<tt>blastall -</tt>" (note the dash). A typical use of <tt>blastall</tt> would be to perform a <tt>blastn</tt> search (nucl. vs. nucl.) of a file called <tt>QUERY</tt> would be:

<pre>blastall -p blastn -d nr -i QUERY -o out.QUERY</pre>

The output is placed into the output file <tt>out.QUERY</tt> and the search is performed against the "<tt>nr</tt>" database. If a protein vs. protein search is desired, then "<tt>blastn</tt>" should be replaced with "<tt>blastp</tt>", etc.

== Blastall arguments / options ==

Some of the most commonly used <tt>blastall</tt> options are:

<pre>
-p Program Name [String]
Input should be one of "blastp", "blastn", "blastx", "tblastn", or "tblastx".
</pre>

<pre>
-d Database [String]
default = nr
</pre>

The database specified must first be formatted with formatdb. Multiple database names (bracketed by quotations) will be accepted.

An example would be

-d "nr est"

which will search both the nr and est databases, presenting the results as if one 'virtual' database consisting of all the entries from both were searched. The statistics are based on the 'virtual' database of nr and est.

<pre>
-i Query File [File In]
default = stdin
</pre>

The query should be in FASTA format. If multiple FASTA entries are in the input file, all queries will be searched.

<pre>
-e Expectation value (E) [Real]
default = 10.0
</pre>

<pre>
-o BLAST report Output File [File Out] Optional
default = stdout
</pre>

<pre>
-F Filter query sequence (DUST with blastn, SEG with others) [String]
default = T
</pre>

BLAST 2.0 and 2.1 uses the dust low-complexity filter for blastn and seg for the other programs. Both 'dust' and 'seg' are integral parts of the NCBI toolkit and are accessed automatically.

If one uses "-F T" then normal filtering by seg or dust (for blastn) occurs (likewise "-F F" means no filtering whatsoever).

This options also takes a string as an argument. One may use such a string to change the specific parameters of seg or invoke other filters. Please see the "Filtering Strings" section (below) for details.

<pre>
-S Query strands to search against database (for blast[nx], and tblastx). 3 is both, 1 is top, 2 is bottom [Integer]
default = 3
</pre>

<pre>
-T Produce HTML output [T/F]
default = F
</pre>

<pre>
-l Restrict search of database to list of GI's [String] Optional
</pre>

This option specifies that only a subset of the database should be searched, determined by the list of gi's (i.e., NCBI identifiers) in a file. One can obtain a list of gi's for a given Entrez query from http://www.ncbi.nlm.nih.gov/Entrez/batch.html. This file should be in the same directory as the database, or in the directory that BLAST is called from.

<pre>
-U Use lower case filtering of FASTA sequence [T/F] Optional
default = F
</pre>

This option specifies that any lower-case letters in the input FASTA file should be masked.

=== Enhancements ===

A new option has been added to search multiple queries at once for the '''blastn''' and '''tblastn''' program options of '''blastall'''.

<pre>
-B Number of concatenated queries, for blastn and tblastn [Integer]
Optional
default = 0
</pre>

This new feature similar in principle, but different in implementation from the support for multiple queries already existing in megablast. The combination of ungapped search (-g F) and multiple queries (-B N) is not supported. The argument to -B option must be equal to the number of sequences in the FASTA input file.

Processing multiple query sequences in one run can be much faster than processing them with separate runs because the database is scanned only 1 time for the entire set of queries. When the -B option is used, the results may differ from the ones produced with individual queries. Usually results will be at least as good or better (in terms of score/evalue) than the results of corresponding individual queries; exceptions occur due to the heuristic nature of BLAST. Additional alignments may appear. It is guaranteed that matching sequences will appear in the same order when they are tied in evalue and are part of the output both with and without -B.
When the -B option is used, the summary statistics at the bottom of the output are for the combined set of queries; at present,
the summary statistics are not tabulated for the individual queries in a multiple-query input.

== Blastall Tutorial ==

In the [ftp://ftp.ncbi.nih.gov/blast/db/ BLAST database FTP directory] you will find the downloadable BLAST database files. For your first search we recommend downloading something relatively small like <tt>ecoli.nt.gz</tt> (1349 Kb). This is a FASTA formatted file of nucleotide sequences which is also compressed. Once uncompressed, you will need to format the database using the '''[[formatdb]]''' program which comes with your Standalone BLAST executable. The list of arguments for this program and all other BLAST programs are located at the end of the README in the [ftp://ftp.ncbi.nih.gov/blast/executable/ Standalone BLAST FTP directory]. Or you can get these arguments by running each of the BLAST programs (<tt>formatdb</tt>, <tt>blastall</tt>, etc.) with a single hyphen as the argument (Example: <tt>formatdb -</tt>). For this document we are just going to show you the basic commands for formatting the database and running your first search.

First, download <tt>ecoli.nt.gz</tt>. For an example, issue the following commands:

<pre>
wget ftp://ftp.ncbi.nih.gov/blast/db/FASTA/ecoli.nt.gz .
gunzip ecoli.nt.gz
</pre>

To format the <tt>ecoli.nt</tt> database run the following from the command line:

<pre>formatdb -i ecoli.nt -p F -o T</pre>

This will create the following seven index files that Standalone BLAST needs to perform the searches and produce results (as well as a log file):
* <tt>ecoli.nt.nhr</tt>
* <tt>ecoli.nt.nin</tt>
* <tt>ecoli.nt.nnd</tt>
* <tt>ecoli.nt.nni</tt>
* <tt>ecoli.nt.nsd</tt>
* <tt>ecoli.nt.nsi</tt>
* <tt>ecoli.nt.nsq</tt>
* <tt>formatdb.log</tt>

The <tt>ecoli.nt</tt> file is not needed after <tt>formatdb</tt> has been done and you can delete this.

Next create a test nucleotide file to run against the new database. It may be easier to 'cheat' here and just extract a portion of a
nucleotide sequence you know is in the downloaded <tt>ecoli.nt</tt> database.

Make a text file called <tt>test.txt</tt> with the following sequence:

<pre>
>Test
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
TTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAA
TATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATGAAACGCATTAGCACCACC
ATTACCACCACCATCACCATTACCACAGGTAACGGTGCGGGCTGACGCGTACAGGAAACACAGAAAAAAG
CCCGCACCTGACAGTGCGGGCTTTTTTTTTCGACCAAAGGTAACGAGGTAACAACCATGCGAGTGTTGAA
GTTCGGCGGTACATCAGTGGCAAATGCAGAACGTTTTCTGCGTGTTGCCGATATTCTGGAAAGCAATGCC
AGGCAGGGGCAGGTGGCCACCGTCCTCTCTGCCCCCGCCAAAATCACCAACCACCTGGTGGCGATGATTG
AAAAAACCATTAGCGGCCAGGATGCTTTACCCAATATCAGCGATGCCGAACGTATTTTTGCCGAACTTTT
</pre>

To run the first search enter the following command from the UNIX command line in your BLAST directory:

<pre>blastall -p blastn -d ecoli.nt -i test.txt -o test.out</pre>

This should generate a results file called <tt>test.out</tt> in the Standalone BLAST directory.

Now you are ready to create your own databases and run BLAST searches.

== See also ==
* [[BLAST]]
* [[Formatdb]]
* [[FASTA format]]

== External links ==
* [http://www.ncbi.nlm.nih.gov/BLAST/ BLAST from NCBI]

[[Category:Academic Research]]
[[Category:Bioinformatics]]

@@ Line 1: / Line 1: @@
 '''Blastall''' allows the use of all BLAST programs (<tt>blastn</tt>, <tt>blastp</tt>, <tt>blastx</tt>, <tt>tblastx</tt>, and <tt>tblastn</tt>).
-== Introduction ==
+==Introduction==
 Blastall may be used to perform all five flavours of blast comparison. One may obtain the <tt>blastall</tt> options by executing "<tt>blastall -</tt>" (note the dash). A typical use of <tt>blastall</tt> would be to perform a <tt>blastn</tt> search (nucleotide ''vs.'' nucleotide) of a file called <code>QUERY</code> would be:
@@ Line 9: / Line 9: @@
 The output is placed into the output file <code>out.QUERY</code> and the search is performed against the "<code>nr</code>" database. If a protein ''vs.'' protein search is desired, then "<tt>blastn</tt>" should be replaced with "<tt>blastp</tt>", etc.
-== Blastall arguments / options ==
+==Blastall arguments / options==
 Some of the most commonly used <tt>blastall</tt> options are:
@@ Line 81: / Line 81: @@
 This option specifies that any lower-case letters in the input FASTA file should be masked.
-=== Enhancements ===
+===Enhancements===
 A new option has been added to search multiple queries at once for the <tt>blastn</tt> and <tt>tblastn</tt> program options of <tt>blastall</tt>.
@@ Line 95: / Line 95: @@
 Processing multiple query sequences in one run can be much faster than processing them with separate runs because the database is scanned only one time for the entire set of queries. When the <code>-B</code> option is used, the results may differ from the ones produced with individual queries. Usually results will be at least as good or better (in terms of score/evalue) than the results of corresponding individual queries; exceptions occur due to the heuristic nature of BLAST. Additional alignments may appear. It is guaranteed that matching sequences will appear in the same order when they are tied in evalue and are part of the output both with and without <code>-B</code>. When the <code>-B</code> option is used, the summary statistics at the bottom of the output are for the combined set of queries; at present, the summary statistics are not tabulated for the individual queries in a multiple-query input.
-== Blastall Tutorial ==
+==Blastall tutorial==
 In the [ftp://ftp.ncbi.nih.gov/blast/db/ BLAST database FTP directory] you will find the downloadable BLAST database files.  For your first search, it is recommended to download something relatively small like <code>ecoli.nt.gz</code> (1349 Kb). This is a FASTA formatted file of nucleotide sequences which is also compressed. Once uncompressed, you will need to format the database using the '''[[formatdb]]''' program which comes with your Standalone BLAST executable. The list of arguments for this program and all other BLAST programs are located at the end of the README in the [ftp://ftp.ncbi.nih.gov/blast/executable/ Standalone BLAST FTP directory]. Or you can get these arguments by running each of the BLAST programs (<tt>formatdb</tt>, <tt>blastall</tt>, etc.) with a single hyphen as the argument (Example: <tt>formatdb -</tt>). For this document we are just going to show you the basic commands for formatting the database and running your first search.
@@ Line 144: / Line 144: @@
 Now you are ready to create your own databases and run BLAST searches.
-== See also ==
+==See also==
-* [[BLAST]]
+*[[BLAST]]
-* [[Formatdb]]
+*[[Formatdb]]
-* [[FASTA format]]
+*[[FASTA format]]
-== External links ==
+==External links==
-* [http://www.ncbi.nlm.nih.gov/BLAST/ BLAST from NCBI]
+*[http://www.ncbi.nlm.nih.gov/BLAST/ BLAST from NCBI]
-* [http://www.ncbi.nlm.nih.gov/BLAST/blastcgihelp.shtml BLAST --help]
+*[http://www.ncbi.nlm.nih.gov/BLAST/blastcgihelp.shtml BLAST --help]
 [[Category:Bioinformatics]]

← Older revision		Revision as of 08:35, 29 December 2006
Line 153:		Line 153:
	* [http://www.ncbi.nlm.nih.gov/BLAST/blastcgihelp.shtml BLAST --help]		* [http://www.ncbi.nlm.nih.gov/BLAST/blastcgihelp.shtml BLAST --help]

−	~~[[Category:Academic Research]]~~
	[[Category:Bioinformatics]]		[[Category:Bioinformatics]]