Christoph: /* See also */

2012-07-26T01:53:09Z

‎See also

Christoph: /* See also */

2012-07-26T01:39:35Z

‎See also

Christoph: /* See also */

2012-07-17T21:00:28Z

‎See also

Christoph: New page: '''FASTQ format''' is a text-based file format for storing both a biological sequence (usually nucleotide sequence) and its corresponding quality scores. Both the sequence letter and quali...

2012-07-17T01:09:42Z

New page: '''FASTQ format''' is a text-based file format for storing both a biological sequence (usually nucleotide sequence) and its corresponding quality scores. Both the sequence letter and quali...

New page

'''FASTQ format''' is a text-based file format for storing both a biological sequence (usually nucleotide sequence) and its corresponding quality scores. Both the sequence letter and quality score are encoded with a single ASCII character for brevity. It was originally developed at the Wellcome Trust Sanger Institute to bundle a [[FASTA format|FASTA]] sequence and its quality data, but has recently become the ''de facto'' standard for storing the output of high throughput sequencing instruments such as the ''Illumina Genome Analyzer''.<ref name="Cock et al 2009">Cock, ''et al.'' (2009). The Sanger FASTQ file format for sequences with quality scores, and the Solexa/Illumina FASTQ variants". ''Nucleic Acids Research''. {{doi|10.1093/nar/gkp1137}}.</ref>

==Format==

A FASTQ file normally uses four lines per sequence. Line 1 begins with a '@' character and is followed by a sequence identifier and an ''optional'' description (like a [[FASTA format|FASTA]] title line). Line 2 is the raw sequence letters. Line 3 begins with a '+' character and is ''optionally'' followed by the same sequence identifier (and any description) again. Line 4 encodes the quality values for the sequence in Line 2, and must contain the same number of symbols as letters in the sequence.

A minimal FASTQ file might look like this:

<pre>
@SEQ_ID
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65
</pre>

The original Sanger FASTQ files also allowed the sequence and quality strings to be wrapped (split over multiple lines), but this is generally discouraged as it can make parsing complicated due to the unfortunate choice of "@" and "+" as markers (these characters can also occur in the quality string).

===Illumina sequence identifiers===

Sequences from the Illumina (Solexa) software use a systematic identifier:

<pre>
@HWUSI-EAS100R:6:73:941:1973#0/1
</pre>

<table class='wikitable'>
<tr><th>HWUSI-EAS100R<td>the unique instrument name
<tr><th>6<td>flowcell lane
<tr><th>73<td>tile number within the flowcell lane
<tr><th>941<td>'x'-coordinate of the cluster within the tile
<tr><th>1973<td>'y'-coordinate of the cluster within the tile
<tr><th>#0<td>index number for a multiplexed sample (0 for no indexing)
<tr><th>/1<td>the member of a pair, /1 or /2 ''(paired-end or mate-pair reads only)''
</table>

Versions of the Illumina pipeline since 1.4 appear to use '''#NNNNNN''' instead of '''#0''' for the multiplex ID, where '''NNNNNN''' is the sequence of the multiplex tag.

With Casava 1.8 the format of the '@' line has changed:

<pre>
@EAS139:136:FC706VJ:2:2104:15343:197393 1:Y:18:ATCACG
</pre>

<table class='wikitable'>
<tr><th>EAS139<td>the unique instrument name
<tr><th>136<td>the run id
<tr><th>FC706VJ<td>the flowcell id
<tr><th>2<td>flowcell lane
<tr><th>2104<td>tile number within the flowcell lane
<tr><th>15343<td>'x'-coordinate of the cluster within the tile
<tr><th>197393<td>'y'-coordinate of the cluster within the tile

<tr><th>1<td>the member of a pair, 1 or 2 ''(paired-end or mate-pair reads only)''
<tr><th>Y<td>Y if the read fails filter (read is bad), N otherwise
<tr><th>18<td>0 when none of the control bits are on, otherwise it is an even number
<tr><th>ATCACG<td>index sequence
</table>

===NCBI Sequence Read Archive===

FASTQ files from the NCBI/EBI [[wikipedia:Sequence Read Archive|Sequence Read Archive]] often include a description, e.g.

<pre>
@SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36
GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACC
+SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36
IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IG9IC
</pre>

In this example there is an NCBI-assigned identifier, and the description holds the original identifier from Solexa/Illumina (as described above) plus the read length.

Also note that the NCBI have converted this FASTQ data from the original Solexa/Illumina encoding to the Sanger standard (see encodings below).

==Variations==

===Encoding===
*Sanger format can encode a [[Phred quality score]] from 0 to 93 using ASCII 33 to 126 (although in raw read data the Phred quality score rarely exceeds 60, higher scores are possible in assemblies or read maps). Also used in SAM format<ref name="Sequence/Alignment Map format">Sequence/Alignment Map format Version 1.0, dated August 2009 [http://samtools.sourceforge.net/SAM1.pdf PDF]</ref>. Coming to the end of February 2011, Illumina's newest version (1.8) of their pipeline CASAVA will directly produce fastq in Sanger format, according to the announcement on seqanswers.com forum.<ref name="Upcoming changes in CASAVA topic">Seqanswer's topic of skruglyak, dated January 2011 [http://seqanswers.com/forums/showthread.php?s=ba8c7dfba863815f637c0bf45882f14b&t=8895 website]</ref>
*Solexa/Illumina 1.0 format can encode a Solexa/Illumina quality score from -5 to 62 using ASCII 59 to 126 (although in raw read data Solexa scores from -5 to 40 only are expected)
*Illumina 1.3+ format can encode a Phred quality score from 0 to 62 using ASCII 64 to 126 (although in raw read data Phred scores from 0 to 40 only are expected).
*The Phred scores 0 to 2 in Illumina 1.5+ have a slightly different meaning. The values 0 and 1 are no longer used and the value 2, encoded by ASCII 66 "B", is used also at the end of reads as a ''Read Segment Quality Control Indicator''.<ref>Illumina Quality Scores, Tobias Mann, Bioinformatics, San Diego, Illumina [http://seqanswers.com/forums/showthread.php?t=4721]</ref> The Illumina manual<ref>[Using Genome Analyzer
Sequencing Control Software, Version 2.6, Catalog # SY-960-2601, Part # 15009921 Rev. A, November 2009]http://watson.nci.nih.gov/solexa/Using_SCSv2.6_15009921_A.pdf</ref> (page 30) states the following: ''If a read ends with a segment of mostly low quality (Q15 or below), then all of the quality values in the segment are replaced with a value of 2 (encoded as the letter B in Illumina's text-based encoding of quality scores)... This Q2 indicator does not predict a specific error rate, but rather indicates that a specific final portion of the read should not be used in further analyses.'' Also, the quality score encoded as "B" letter may occur internally within reads at least as late as pipeline version 1.6, as shown in the following example:

<pre>
@HWI-EAS209_0006_FC706VJ:5:58:5894:21141#ATCACG/1
TTAATTGGTAAATAAATCTCCTAATAGCTTAGATNTTACCTTNNNNNNNNNNTAGTTTCTTGAGATTTGTTGGGGGAGACATTTTTGTGATTGCCTTGAT
+HWI-EAS209_0006_FC706VJ:5:58:5894:21141#ATCACG/1
efcfffffcfeefffcffffffddf`feed]`]_Ba_^__[YBBBBBBBBBBRTT\]][]dddd`ddd^dddadd^BBBBBBBBBBBBBBBBBBBBBBBB
</pre>

An alternative interpretation of this ASCII encoding has been proposed.<ref>[http://solexaqa.sourceforge.net/questions.htm#illumina SolexaQA project website]</ref> Also, in Illumina runs using PhiX controls, the character 'B' was observed to represent an "unknown quality score". The error rate of 'B' reads was roughly 3 phred scores lower the mean observed score of a given run.

For raw reads, the range of scores will depend on the technology and the base caller used, but will typically be up to 40. Recent Illumina chemistry changes have resulted in reported quality scores of 41, which has broken various scripts and tools expecting an upper bound of 40. For aligned sequences and consensuses higher scores are common.

SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS.....................................................
..........................XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX......................
...............................IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII......................
.................................'''J'''JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ......................
LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL....................................................
!"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~
| | | | | |
33 59 64 73 104 126

S - Sanger Phred+33, raw reads typically (0, 40)
X - Solexa Solexa+64, raw reads typically (-5, 40)
I - Illumina 1.3+ Phred+64, raw reads typically (0, 40)
J - Illumina 1.5+ Phred+64, raw reads typically (3, 40)
with 0=unused, 1=unused, 2=Read Segment Quality Control Indicator (bold)
(Note: See discussion above).
L - Illumina 1.8+ Phred+33, raw reads typically (0, 41)

===Color space===
For SOLiD data, the sequence is in color space, except the first position. The quality values are those of the Sanger format. Alignment tools differ in their preferred version of the quality values: some include a quality score (set to 0, i.e. '!') for the leading nucleotide, others do not. The sequence read archive includes this quality score.

==File extension==
There is no standard file extension for a FASTQ file, but .fq, .fastq, and .txt are commonly used.

==Format converters==
*Biopython, version 1.51 onwards (interconverts Sanger, Solexa and Illumina 1.3+)
*[[:Category:EMBOSS|EMBOSS]], version 6.1.0 patch 1 onwards (interconverts Sanger, Solexa and Illumina 1.3+)
*BioPerl, version 1.6.1 onwards (interconverts Sanger, Solexa and Illumina 1.3+)
*BioRuby, version 1.4.0 onwards (interconverts Sanger, Solexa and Illumina 1.3+)
*BioJava, version 1.7.1 to 1.8.x (interconverts Sanger, Solexa and Illumina 1.3+)
*[http://maq.sourceforge.net MAQ] can convert from Solexa to Sanger (use this [http://sourceforge.net/tracker/index.php?func=detail&aid=2824334&group_id=191815&atid=938893 patch] to support Illumina 1.3+ files).
*[http://hannonlab.cshl.edu/fastx_toolkit/ fastx_toolkit] The included fastq_quality_converter program can convert Illumina to Sanger

==See also==
*[[FASTA format]]

==References==
<references/>

==External links==
*[http://maq.sourceforge.net/fastq.shtml MAQ] webpage discussing FASTQ variants
*[http://bitbucket.org/galaxy/galaxy-central/src/tip/tools/fastq/ Galaxy fastq tools]
*[http://hannonlab.cshl.edu/fastx_toolkit/ Fastx toolkit] collection of command line tools for Short-Reads FASTA/FASTQ files preprocessing
*[http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/ Fastqc] quality control tool for high throughput sequence data
*[http://prinseq.sourceforge.net/ PRINSEQ] can be used for QC and to filter, reformat, or trim sequence data (web-based and command line versions)

[[Category:Bioinformatics]]

@@ Line 142: / Line 142: @@
 ==See also==
 *[http://genome.ucsc.edu/FAQ/FAQformat.html UCSC Data File Formats FAQ]
 *[[FASTA format]]
 *[http://www.broadinstitute.org/crd/wiki/index.php/Qual Qual format] &mdash; a standard file format for read and contig quality scores.

FASTQ format - Revision history

Christoph: /* See also */

Christoph: /* See also */

Christoph: /* See also */

Christoph: New page: '''FASTQ format''' is a text-based file format for storing both a biological sequence (usually nucleotide sequence) and its corresponding quality scores. Both the sequence letter and quali...