Difference between revisions of "Z-Hunt"

From Christoph's Personal Wiki
Jump to: navigation, search
Line 1: Line 1:
−
'''ZHUNT''' (aka '''Z-Hunt''' or '''ZHunt''') is an algorithm for predicting the propensity of DNA to flip from the B-form to the [[Z-DNA|Z-form]]. The original algorithm was written by [[Dr. P. Shing Ho Laboratory|Dr. P. Shing Ho]] in 1986<ref name=Ho86>Ho PS, Ellison MJ, Quigley GJ, Rich A (1986). A computer aided thermodynamic approach for predicting the formation of Z-DNA in naturally occurring sequences. ''EMBO J, 5(10):2737-2744''.</ref> and was later developed by Tracy Camp, [[Christoph Champ|P. Christoph Champ]], Sandor Maurice, and Jeffrey M. Vargason for genome-wide mapping of [[Z-DNA]] (with P. Shing Ho as the principal investigator)<ref>[[Christoph Champ|Champ PC]], Maurice S, Vargason JM, Camp T, Ho PS (2004). Distributions of Z-DNA and nuclear factor I in human chromosome 22: a model for coupled transcriptional regulation. ''Nucleic Acids Research, 32(22):6501-6510''.</ref>. Z-Hunt is available for use Online at [http://gac-web.cgrb.oregonstate.edu/zDNA/ ZHunt Online].
+
'''ZHUNT''' (aka '''Z-Hunt''' or '''ZHunt''') is an algorithm for predicting the propensity of DNA to flip from the B-form to the [[Z-DNA|Z-form]]. The original algorithm was written by [[Dr. P. Shing Ho Laboratory|Dr. P. Shing Ho]] in 1986<ref name="Ho1986">Ho PS, Ellison MJ, Quigley GJ, Rich A (1986). A computer aided thermodynamic approach for predicting the formation of Z-DNA in naturally occurring sequences. ''EMBO J, 5(10):2737-2744''.</ref> and was later developed by Tracy Camp, [[Christoph Champ|P. Christoph Champ]], Sandor Maurice, and Jeffrey M. Vargason for genome-wide mapping of [[Z-DNA]] (with P. Shing Ho as the principal investigator)<ref name="Champ2004">[[Christoph Champ|Champ PC]], Maurice S, Vargason JM, Camp T, Ho PS (2004). Distributions of Z-DNA and nuclear factor I in human chromosome 22: a model for coupled transcriptional regulation. ''Nucleic Acids Research, 32(22):6501-6510''.</ref>. ZHUNT is available for use Online at [http://gac-web.cgrb.oregonstate.edu/zDNA/ ZHunt Online].
 +
 
 +
==Introduction==
 +
===Description===
 +
<div style="padding: 1em; margin: 10px; border: 2px dotted #18e;">
 +
ZHUNT was constructed as a program to predict the formation of Z-DNA for any sequence of ''n'' dinucleotides. A branching algorithm is used to find the minimum total propagation energy for the sequence to assign the &Delta;''G''° values to calculate the propagation term (''S'') for each dinucleotide in the simple set of nested DO LOOPS for the product and summation terms of ''Q'' and <&Delta;''Tw''> as the program walks through a sequence. The complete output from the includes the "best" stretch of Z-DNA dinucleotides in the sequence, the ''anti-syn'' assignments for the dinucleotides in this stretch, the <&Delta;''Tw''> and the &Delta;''Lk<sub>m</sub>'' for the stretch&mdash;the lower the &Delta;''Lk<sub>m</sub>'', the higher the potential that the sequence will form Z-DNA.
 +
 
 +
In order for the &Delta;''Lk<sub>m</sub>'' values to be useful as a predictive tool, they are converted to propensities for forming Z-DNA relative to random sequences. Thus, the &Delta;''Lk<sub>m</sub>'' value is compared to those for a set of randomly generated sequences to calculate a propensity (originally called a ''Z-score''<ref name="Ho1986"/>, but now referred to a ''P<sub>Z</sub>''<ref name="Champ2004"/>), which reflects the propensity for the sequence to form Z-DNA. ''P<sub>Z</sub>'' for a particular sequence is defined as the number of random sequences that one must search in order to find one that has a similar or higher propensity to form Z-DNA, and has units of base pairs (bp).<ref name="Ho2008">Ho PS (2008). "Thermogenomics: Thermodynamic-based approaches to genomic analyses of DNA structure". ''Methods, [Epub ahead of print]''. PMID: 18848994. {{doi|10.1016/j.ymeth.2008.09.007}}</ref>
 +
</div>
 +
 
 +
===Terms===
 +
;&Delta;''Lk<sub>m</sub>'' : linking number
 +
;<&Delta;''Tw''> : change in helical twist
 +
;&Delta;''Wr'' : change in writhe = &Delta;''Wr'' = &Delta;''Lk<sub>m</sub>'' &ndash; <&Delta;''Tw''>
 +
;&Delta;''G''° : overall energy associated with the transition from B-DNA to Z-DNA; &Delta;''G''° = K(&Delta;''Lk<sub>m</sub>'' &ndash; &Delta;''Tw<sub>m</sub>'')<sup>2</sup>
 +
;''K'' : ''K'' = 1100''RT''/''N'', for ''N'' number of base pairs in the DNA plasmid (see: <ref name="Ho2008"/> for description)
 +
;''Q'' : partition function
 +
::[[Image:Partition function.png]]
 +
::for propagation of Z-DNA through ''n'' number of dinucleotides, and 0.179 is the &Delta;''Tw'' for each dinucleotide and 0.4 is the &Delta;''Tw'' of the two B&ndash;Z junctions.
  
 
==Z-score==
 
==Z-score==
−
Note: The following table is a list of test sequences with their corresponding conformational assignments and Z-scores. This "Z-score" should not be confused with the statistical "[[wikipedia:Standard score|Standard score]]". Here, it describes the propensity of a given sequence to adopt the left-handed form of DNA; it is simply a probability score.
+
Note: The following table is a list of test sequences with their corresponding conformational assignments and Z-scores (now called "''P<sub>Z</sub>''" scores). This "Z-score" should not be confused with the statistical "[[wikipedia:Standard score|Standard score]]". Here, it describes the propensity of a given sequence to adopt the left-handed form of DNA; it is simply a probability score.
 
<div style="float:left; margin:0px 20px 20px 0px;">
 
<div style="float:left; margin:0px 20px 20px 0px;">
 
{| align="center" style="border: 1px solid #999; background-color:#FFFFFF"
 
{| align="center" style="border: 1px solid #999; background-color:#FFFFFF"
Line 50: Line 68:
 
|}
 
|}
 
</div>
 
</div>
 +
 +
==Keywords and abbreviations==
 +
*Keywords: Z-DNA; Nuclear factor I; Transcription regulation; Thermogenomics
 +
*Abbreviations: ZDR, potential Z-DNA regions; NFI, nuclear factor I; CSF, colony stimulating factor
  
 
==See also==
 
==See also==

Revision as of 07:19, 25 December 2008

ZHUNT (aka Z-Hunt or ZHunt) is an algorithm for predicting the propensity of DNA to flip from the B-form to the Z-form. The original algorithm was written by Dr. P. Shing Ho in 1986[1] and was later developed by Tracy Camp, P. Christoph Champ, Sandor Maurice, and Jeffrey M. Vargason for genome-wide mapping of Z-DNA (with P. Shing Ho as the principal investigator)[2]. ZHUNT is available for use Online at ZHunt Online.

Introduction

Description

ZHUNT was constructed as a program to predict the formation of Z-DNA for any sequence of n dinucleotides. A branching algorithm is used to find the minimum total propagation energy for the sequence to assign the ΔG° values to calculate the propagation term (S) for each dinucleotide in the simple set of nested DO LOOPS for the product and summation terms of Q and <ΔTw> as the program walks through a sequence. The complete output from the includes the "best" stretch of Z-DNA dinucleotides in the sequence, the anti-syn assignments for the dinucleotides in this stretch, the <ΔTw> and the ΔLkm for the stretch—the lower the ΔLkm, the higher the potential that the sequence will form Z-DNA.

In order for the ΔLkm values to be useful as a predictive tool, they are converted to propensities for forming Z-DNA relative to random sequences. Thus, the ΔLkm value is compared to those for a set of randomly generated sequences to calculate a propensity (originally called a Z-score[1], but now referred to a PZ[2]), which reflects the propensity for the sequence to form Z-DNA. PZ for a particular sequence is defined as the number of random sequences that one must search in order to find one that has a similar or higher propensity to form Z-DNA, and has units of base pairs (bp).[3]

Terms

ΔLkm 
linking number
<ΔTw> 
change in helical twist
ΔWr 
change in writhe = ΔWr = ΔLkm – <ΔTw>
ΔG° 
overall energy associated with the transition from B-DNA to Z-DNA; ΔG° = K(ΔLkm – ΔTwm)2
K 
K = 1100RT/N, for N number of base pairs in the DNA plasmid (see: [3] for description)
Q 
partition function
Partition function.png
for propagation of Z-DNA through n number of dinucleotides, and 0.179 is the ΔTw for each dinucleotide and 0.4 is the ΔTw of the two B–Z junctions.

Z-score

Note: The following table is a list of test sequences with their corresponding conformational assignments and Z-scores (now called "PZ" scores). This "Z-score" should not be confused with the statistical "Standard score". Here, it describes the propensity of a given sequence to adopt the left-handed form of DNA; it is simply a probability score. 

Sequence/conf. assignments  | Z-score
----------------------------|------------
CGCGCGCGCGCGCGCGCGCGCGCG    | 2 x 10e+11
ASASASASASASASASASASASAS    |
                            |
CGCGCGCGCGCG                | 4 x 10e+07
ASASASASASAS                |
                            |
CACACACACACACACACACACACA    | 2 x 10e+05
ASASASASASASASASASASASAS    |
                            |
CACACACACACA                | 2 x 10e+04
ASASASASASAS                |
                            |
CGCGCGCGCGCG GCGCGCGCGCGC   | 2 x 10e+08
ASASASASASAS SASASASASASA   |
                            |
CGCGCG GCGCGC CGCGCG GCGCGC | 7 x 10e+04
ASASAS SASASA ASASAS SASASA |
                            |
 *   *   *   *   *   *      |
CCCGCCCGCCCGCCCGCCCGCCCG    | 8 x 10e+04
ASASASASASASASASASASASAS    |
                            |
  *   *   *   *   *   *     |
CAGGCAGGCAGGCAGGCAGGCAGG    | 1 x 10e+03
ASASASASASASASASASASASAS    |
                            |
 * * * * * * * * * * * *    |
CCCCCCCCCCCCCCCCCCCCCCCC    | 52
ASASASASASASASASASASASAS    |
                            |
ATATATATATATATATATATATAT    | 38
SASASASASASASASASASASASA    |
                            |
AAAAAAAAAAAAAAAAAAAAAAAA    | 3 x 10e-07
ASASASASASASASASASASASAS    |
Various test sequences are shown with their corresponding Z-score as assigned by Z-hunt [version 1]. Z-scores are defined as the number of random base pairs that must be scanned, on average, to find a sequence with equal or better Z-forming capacity relative to the sequence in question. The conformation selected by Z-hunt for each nucleotide (A for anti and S for syn) are indicated below each sequence. Bases which deviate from perfect purine-pyrimidine alternation are designated by dots above that nucleotide. Discontinuities in the conformational phases produced by Z-Z junctions are represented by gaps separating the sequence.[4]

Keywords and abbreviations

  • Keywords: Z-DNA; Nuclear factor I; Transcription regulation; Thermogenomics
  • Abbreviations: ZDR, potential Z-DNA regions; NFI, nuclear factor I; CSF, colony stimulating factor

See also

References

  1. ↑ 1.0 1.1 Ho PS, Ellison MJ, Quigley GJ, Rich A (1986). A computer aided thermodynamic approach for predicting the formation of Z-DNA in naturally occurring sequences. EMBO J, 5(10):2737-2744.
  2. ↑ 2.0 2.1 Champ PC, Maurice S, Vargason JM, Camp T, Ho PS (2004). Distributions of Z-DNA and nuclear factor I in human chromosome 22: a model for coupled transcriptional regulation. Nucleic Acids Research, 32(22):6501-6510.
  3. ↑ 3.0 3.1 Ho PS (2008). "Thermogenomics: Thermodynamic-based approaches to genomic analyses of DNA structure". Methods, [Epub ahead of print]. PMID: 18848994. DOI:10.1016/j.ymeth.2008.09.007
  4. ↑ Ho PS, Ellison MJ, Quigley GJ, Rich A (1986). A computer aided thermodynamic approach for predicting the formation of Z-DNA in naturally occurring sequences. EMBO J, 5(10):2737-2744.

Further reading

  • Ho PS (2008). "Thermogenomics: Thermodynamic-based approaches to genomic analyses of DNA structure". Methods, [Epub ahead of print]. PMID: 18848994. DOI:10.1016/j.ymeth.2008.09.007
  • Ho PS (1994). The non-B-DNA structure of d(CA/TG)n does not differ from that of Z-DNA. Proc Natl Acad Sci USA, 91(20):9549-9553.
  • Schroth GP, Chou PJ, Ho PS (1992). Mapping Z-DNA in the human genome. Computer-aided mapping reveals a nonrandom distribution of potential Z-DNA-forming sequences in human genes. J Biol Chem, 267(17):11846-55.

External links

  • ZHunt Online Server — front end by Sandor Maurice; back end by Sandor Maurice and P. Christoph Champ.
  • make-na server — create custom DNA structures (in PDB format)
Retrieved from "http://wiki.christophchamp.com/index.php?title=Z-Hunt&oldid=5214"