FASTQ format

FASTQ format is a text-based file format for storing both a biological sequence (usually nucleotide sequence) and its corresponding quality scores. Both the sequence letter and quality score are encoded with a single ASCII character for brevity. It was originally developed at the Wellcome Trust Sanger Institute to bundle a FASTA sequence and its quality data, but has recently become the de facto standard for storing the output of high throughput sequencing instruments such as the Illumina Genome Analyzer.

Format

A FASTQ file normally uses four lines per sequence. Line 1 begins with a '@' character and is followed by a sequence identifier and an optional description (like a FASTA title line). Line 2 is the raw sequence letters. Line 3 begins with a '+' character and is optionally followed by the same sequence identifier (and any description) again. Line 4 encodes the quality values for the sequence in Line 2, and must contain the same number of symbols as letters in the sequence.

A minimal FASTQ file might look like this:

@SEQ_ID
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65

The original Sanger FASTQ files also allowed the sequence and quality strings to be wrapped (split over multiple lines), but this is generally discouraged as it can make parsing complicated due to the unfortunate choice of "@" and "+" as markers (these characters can also occur in the quality string).

Illumina sequence identifiers

Sequences from the Illumina (Solexa) software use a systematic identifier:

@HWUSI-EAS100R:6:73:941:1973#0/1

HWUSI-EAS100R	the unique instrument name
6	flowcell lane
73	tile number within the flowcell lane
941	'x'-coordinate of the cluster within the tile
1973	'y'-coordinate of the cluster within the tile
#0	index number for a multiplexed sample (0 for no indexing)
/1	the member of a pair, /1 or /2 (paired-end or mate-pair reads only)

Versions of the Illumina pipeline since 1.4 appear to use #NNNNNN instead of #0 for the multiplex ID, where NNNNNN is the sequence of the multiplex tag.

With Casava 1.8 the format of the '@' line has changed:

@EAS139:136:FC706VJ:2:2104:15343:197393 1:Y:18:ATCACG

EAS139	the unique instrument name
136	the run id
FC706VJ	the flowcell id
2	flowcell lane
2104	tile number within the flowcell lane
15343	'x'-coordinate of the cluster within the tile
197393	'y'-coordinate of the cluster within the tile
1	the member of a pair, 1 or 2 (paired-end or mate-pair reads only)
Y	Y if the read fails filter (read is bad), N otherwise
18	0 when none of the control bits are on, otherwise it is an even number
ATCACG	index sequence

NCBI Sequence Read Archive

FASTQ files from the NCBI/EBI Sequence Read Archive often include a description, e.g.

@SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36
GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACC
+SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36
IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IG9IC

In this example there is an NCBI-assigned identifier, and the description holds the original identifier from Solexa/Illumina (as described above) plus the read length.

Also note that the NCBI have converted this FASTQ data from the original Solexa/Illumina encoding to the Sanger standard (see encodings below).

Variations

Encoding

• Sanger format can encode a Phred quality score from 0 to 93 using ASCII 33 to 126 (although in raw read data the Phred quality score rarely exceeds 60, higher scores are possible in assemblies or read maps). Also used in SAM format. Coming to the end of February 2011, Illumina's newest version (1.8) of their pipeline CASAVA will directly produce fastq in Sanger format, according to the announcement on seqanswers.com forum.
• Solexa/Illumina 1.0 format can encode a Solexa/Illumina quality score from -5 to 62 using ASCII 59 to 126 (although in raw read data Solexa scores from -5 to 40 only are expected)
• Illumina 1.3+ format can encode a Phred quality score from 0 to 62 using ASCII 64 to 126 (although in raw read data Phred scores from 0 to 40 only are expected).
• The Phred scores 0 to 2 in Illumina 1.5+ have a slightly different meaning. The values 0 and 1 are no longer used and the value 2, encoded by ASCII 66 "B", is used also at the end of reads as a Read Segment Quality Control Indicator. The Illumina manual (page 30) states the following: If a read ends with a segment of mostly low quality (Q15 or below), then all of the quality values in the segment are replaced with a value of 2 (encoded as the letter B in Illumina's text-based encoding of quality scores)... This Q2 indicator does not predict a specific error rate, but rather indicates that a specific final portion of the read should not be used in further analyses. Also, the quality score encoded as "B" letter may occur internally within reads at least as late as pipeline version 1.6, as shown in the following example:

@HWI-EAS209_0006_FC706VJ:5:58:5894:21141#ATCACG/1
TTAATTGGTAAATAAATCTCCTAATAGCTTAGATNTTACCTTNNNNNNNNNNTAGTTTCTTGAGATTTGTTGGGGGAGACATTTTTGTGATTGCCTTGAT
+HWI-EAS209_0006_FC706VJ:5:58:5894:21141#ATCACG/1
efcfffffcfeefffcffffffddf`feed]`]_Ba_^__[YBBBBBBBBBBRTT\]][]dddd`ddd^dddadd^BBBBBBBBBBBBBBBBBBBBBBBB

An alternative interpretation of this ASCII encoding has been proposed. Also, in Illumina runs using PhiX controls, the character 'B' was observed to represent an "unknown quality score". The error rate of 'B' reads was roughly 3 phred scores lower the mean observed score of a given run.

For raw reads, the range of scores will depend on the technology and the base caller used, but will typically be up to 40. Recent Illumina chemistry changes have resulted in reported quality scores of 41, which has broken various scripts and tools expecting an upper bound of 40. For aligned sequences and consensuses higher scores are common.

  SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS.....................................................
  ..........................XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX......................
  ...............................IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII......................
  .................................JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ......................
  LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL....................................................
  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~
  |                         |    |        |                              |                     |
 33                        59   64       73                            104                   126

 S - Sanger        Phred+33,  raw reads typically (0, 40)
 X - Solexa        Solexa+64, raw reads typically (-5, 40)
 I - Illumina 1.3+ Phred+64,  raw reads typically (0, 40)
 J - Illumina 1.5+ Phred+64,  raw reads typically (3, 40)
    with 0=unused, 1=unused, 2=Read Segment Quality Control Indicator (bold) 
    (Note: See discussion above).
 L - Illumina 1.8+ Phred+33,  raw reads typically (0, 41)

Color space

For SOLiD data, the sequence is in color space, except the first position. The quality values are those of the Sanger format. Alignment tools differ in their preferred version of the quality values: some include a quality score (set to 0, i.e. '!') for the leading nucleotide, others do not. The sequence read archive includes this quality score.

File extension

There is no standard file extension for a FASTQ file, but .fq, .fastq, and .txt are commonly used.

Format converters

• Biopython, version 1.51 onwards (interconverts Sanger, Solexa and Illumina 1.3+)
• EMBOSS, version 6.1.0 patch 1 onwards (interconverts Sanger, Solexa and Illumina 1.3+)
• BioPerl, version 1.6.1 onwards (interconverts Sanger, Solexa and Illumina 1.3+)
• BioRuby, version 1.4.0 onwards (interconverts Sanger, Solexa and Illumina 1.3+)
• BioJava, version 1.7.1 to 1.8.x (interconverts Sanger, Solexa and Illumina 1.3+)
• MAQ can convert from Solexa to Sanger (use this patch to support Illumina 1.3+ files).
• fastx_toolkit The included fastq_quality_converter program can convert Illumina to Sanger

See also

• UCSC Data File Formats FAQ
• List of file formats in molecular biology
• FASTA format
• Qual format — a standard file format for read and contig quality scores.
• Phred quality score

External links

• MAQ webpage discussing FASTQ variants
• Galaxy fastq tools
• Fastx toolkit collection of command line tools for Short-Reads FASTA/FASTQ files preprocessing
• Fastqc quality control tool for high throughput sequence data
• PRINSEQ can be used for QC and to filter, reformat, or trim sequence data (web-based and command line versions)