http://wiki.christophchamp.com/index.php?title=Z-Hunt&feed=atom&action=history
Z-Hunt - Revision history
2024-03-28T08:50:57Z
Revision history for this page on the wiki
MediaWiki 1.26.2
http://wiki.christophchamp.com/index.php?title=Z-Hunt&diff=6233&oldid=prev
Christoph: /* External links */
2015-01-23T01:03:33Z
<p><span dir="auto"><span class="autocomment">External links</span></span></p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;' lang='en'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 01:03, 23 January 2015</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l92" >Line 92:</td>
<td colspan="2" class="diff-lineno">Line 92:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>==External links==</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>==External links==</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>*[http://gac-web.cgrb.oregonstate.edu/zDNA/ ZHunt Online Server] (''website currently offline'') &mdash; front end by Sandor Maurice; back end by Sandor Maurice and P. Christoph Champ.</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>*[http://gac-web.cgrb.oregonstate.edu/zDNA/ ZHunt Online Server] (''website currently offline'') &mdash; front end by Sandor Maurice; back end by Sandor Maurice and P. Christoph Champ.</div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">*[http://nonb.abcc.ncifcrf.gov non-B DB] &mdash; a database of predicted non-B DNA-forming motifs and its associated tools.</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>*[http://structure.usc.edu/make-na/ make-na server] &mdash; create custom DNA structures (in PDB format)</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>*[http://structure.usc.edu/make-na/ make-na server] &mdash; create custom DNA structures (in PDB format)</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>[[Category:Academic Research]]</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>[[Category:Academic Research]]</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>[[Category:Portfolio]]</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>[[Category:Portfolio]]</div></td></tr>
</table>
Christoph
http://wiki.christophchamp.com/index.php?title=Z-Hunt&diff=5999&oldid=prev
Christoph: /* External links */
2014-02-18T18:51:09Z
<p><span dir="auto"><span class="autocomment">External links</span></span></p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;' lang='en'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 18:51, 18 February 2014</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l91" >Line 91:</td>
<td colspan="2" class="diff-lineno">Line 91:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>==External links==</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>==External links==</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>*[http://gac-web.cgrb.oregonstate.edu/zDNA/ ZHunt Online Server] &mdash; front end by Sandor Maurice; back end by Sandor Maurice and P. Christoph Champ.</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>*[http://gac-web.cgrb.oregonstate.edu/zDNA/ ZHunt Online Server] <ins class="diffchange diffchange-inline">(''website currently offline'') </ins>&mdash; front end by Sandor Maurice; back end by Sandor Maurice and P. Christoph Champ.</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>*[http://structure.usc.edu/make-na/ make-na server] &mdash; create custom DNA structures (in PDB format)</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>*[http://structure.usc.edu/make-na/ make-na server] &mdash; create custom DNA structures (in PDB format)</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>[[Category:Academic Research]]</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>[[Category:Academic Research]]</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>[[Category:Portfolio]]</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>[[Category:Portfolio]]</div></td></tr>
</table>
Christoph
http://wiki.christophchamp.com/index.php?title=Z-Hunt&diff=5521&oldid=prev
Christoph: /* External links */
2012-02-18T18:33:46Z
<p><span dir="auto"><span class="autocomment">External links</span></span></p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;' lang='en'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 18:33, 18 February 2012</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l95" >Line 95:</td>
<td colspan="2" class="diff-lineno">Line 95:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>[[Category:Academic Research]]</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>[[Category:Academic Research]]</div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">[[Category:Portfolio]]</ins></div></td></tr>
</table>
Christoph
http://wiki.christophchamp.com/index.php?title=Z-Hunt&diff=5217&oldid=prev
Christoph: /* Terms */
2008-12-25T07:46:41Z
<p><span dir="auto"><span class="autocomment">Terms</span></span></p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;' lang='en'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 07:46, 25 December 2008</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l18" >Line 18:</td>
<td colspan="2" class="diff-lineno">Line 18:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>::[[Image:Partition function.png]]</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>::[[Image:Partition function.png]]</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>::for propagation of Z-DNA through ''n'' number of dinucleotides, and 0.179 is the &Delta;''Tw'' for each dinucleotide and 0.4 is the &Delta;''Tw'' of the two B&ndash;Z junctions.</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>::for propagation of Z-DNA through ''n'' number of dinucleotides, and 0.179 is the &Delta;''Tw'' for each dinucleotide and 0.4 is the &Delta;''Tw'' of the two B&ndash;Z junctions.</div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">;<&Delta;''Tw''> : change in overall helical twist</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">::[[Image:Change in overall twist.png|800px]]</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>==Z-score==</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>==Z-score==</div></td></tr>
</table>
Christoph
http://wiki.christophchamp.com/index.php?title=Z-Hunt&diff=5214&oldid=prev
Christoph at 07:19, 25 December 2008
2008-12-25T07:19:57Z
<p></p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;' lang='en'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 07:19, 25 December 2008</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l1" >Line 1:</td>
<td colspan="2" class="diff-lineno">Line 1:</td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>'''ZHUNT''' (aka '''Z-Hunt''' or '''ZHunt''') is an algorithm for predicting the propensity of DNA to flip from the B-form to the [[Z-DNA|Z-form]]. The original algorithm was written by [[Dr. P. Shing Ho Laboratory|Dr. P. Shing Ho]] in 1986<ref name=<del class="diffchange diffchange-inline">Ho86</del>>Ho PS, Ellison MJ, Quigley GJ, Rich A (1986). A computer aided thermodynamic approach for predicting the formation of Z-DNA in naturally occurring sequences. ''EMBO J, 5(10):2737-2744''.</ref> and was later developed by Tracy Camp, [[Christoph Champ|P. Christoph Champ]], Sandor Maurice, and Jeffrey M. Vargason for genome-wide mapping of [[Z-DNA]] (with P. Shing Ho as the principal investigator)<ref>[[Christoph Champ|Champ PC]], Maurice S, Vargason JM, Camp T, Ho PS (2004). Distributions of Z-DNA and nuclear factor I in human chromosome 22: a model for coupled transcriptional regulation. ''Nucleic Acids Research, 32(22):6501-6510''.</ref>. <del class="diffchange diffchange-inline">Z-Hunt </del>is available for use Online at [http://gac-web.cgrb.oregonstate.edu/zDNA/ ZHunt Online].</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>'''ZHUNT''' (aka '''Z-Hunt''' or '''ZHunt''') is an algorithm for predicting the propensity of DNA to flip from the B-form to the [[Z-DNA|Z-form]]. The original algorithm was written by [[Dr. P. Shing Ho Laboratory|Dr. P. Shing Ho]] in 1986<ref name=<ins class="diffchange diffchange-inline">"Ho1986"</ins>>Ho PS, Ellison MJ, Quigley GJ, Rich A (1986). A computer aided thermodynamic approach for predicting the formation of Z-DNA in naturally occurring sequences. ''EMBO J, 5(10):2737-2744''.</ref> and was later developed by Tracy Camp, [[Christoph Champ|P. Christoph Champ]], Sandor Maurice, and Jeffrey M. Vargason for genome-wide mapping of [[Z-DNA]] (with P. Shing Ho as the principal investigator)<ref <ins class="diffchange diffchange-inline">name="Champ2004"</ins>>[[Christoph Champ|Champ PC]], Maurice S, Vargason JM, Camp T, Ho PS (2004). Distributions of Z-DNA and nuclear factor I in human chromosome 22: a model for coupled transcriptional regulation. ''Nucleic Acids Research, 32(22):6501-6510''.</ref>. <ins class="diffchange diffchange-inline">ZHUNT </ins>is available for use Online at [http://gac-web.cgrb.oregonstate.edu/zDNA/ ZHunt Online]<ins class="diffchange diffchange-inline">.</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div> </div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">==Introduction==</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">===Description===</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline"><div style="padding: 1em; margin: 10px; border: 2px dotted #18e;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">ZHUNT was constructed as a program to predict the formation of Z-DNA for any sequence of ''n'' dinucleotides. A branching algorithm is used to find the minimum total propagation energy for the sequence to assign the &Delta;''G''° values to calculate the propagation term (''S'') for each dinucleotide in the simple set of nested DO LOOPS for the product and summation terms of ''Q'' and <&Delta;''Tw''> as the program walks through a sequence. The complete output from the includes the "best" stretch of Z-DNA dinucleotides in the sequence, the ''anti-syn'' assignments for the dinucleotides in this stretch, the <&Delta;''Tw''> and the &Delta;''Lk<sub>m</sub>'' for the stretch&mdash;the lower the &Delta;''Lk<sub>m</sub>'', the higher the potential that the sequence will form Z-DNA.</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div> </div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">In order for the &Delta;''Lk<sub>m</sub>'' values to be useful as a predictive tool, they are converted to propensities for forming Z-DNA relative to random sequences. Thus, the &Delta;''Lk<sub>m</sub>'' value is compared to those for a set of randomly generated sequences to calculate a propensity (originally called a ''Z-score''<ref name="Ho1986"/>, but now referred to a ''P<sub>Z</sub>''<ref name="Champ2004"/>), which reflects the propensity for the sequence to form Z-DNA. ''P<sub>Z</sub>'' for a particular sequence is defined as the number of random sequences that one must search in order to find one that has a similar or higher propensity to form Z-DNA, and has units of base pairs (bp).<ref name="Ho2008">Ho PS (2008). "Thermogenomics: Thermodynamic-based approaches to genomic analyses of DNA structure". ''Methods, [Epub ahead of print]''. PMID: 18848994. {{doi|10.1016/j.ymeth.2008.09.007}}</ref></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline"></div></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div> </div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">===Terms===</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">;&Delta;''Lk<sub>m</sub>'' : linking number</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">;<&Delta;''Tw''> : change in helical twist</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">;&Delta;''Wr'' : change in writhe = &Delta;''Wr'' = &Delta;''Lk<sub>m</sub>'' &ndash; <&Delta;''Tw''></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">;&Delta;''G''° : overall energy associated with the transition from B-DNA to Z-DNA; &Delta;''G''° = K(&Delta;''Lk<sub>m</sub>'' &ndash; &Delta;''Tw<sub>m</sub>'')<sup>2</sup></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">;''K'' : ''K'' = 1100''RT''/''N'', for ''N'' number of base pairs in the DNA plasmid (see: <ref name="Ho2008"/> for description)</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">;''Q'' : partition function</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">::[[Image:Partition function.png]]</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">::for propagation of Z-DNA through ''n'' number of dinucleotides, and 0.179 is the &Delta;''Tw'' for each dinucleotide and 0.4 is the &Delta;''Tw'' of the two B&ndash;Z junctions</ins>.</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>==Z-score==</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>==Z-score==</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>Note: The following table is a list of test sequences with their corresponding conformational assignments and Z-scores. This "Z-score" should not be confused with the statistical "[[wikipedia:Standard score|Standard score]]". Here, it describes the propensity of a given sequence to adopt the left-handed form of DNA; it is simply a probability score.</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>Note: The following table is a list of test sequences with their corresponding conformational assignments and Z-scores <ins class="diffchange diffchange-inline">(now called "''P<sub>Z</sub>''" scores)</ins>. This "Z-score" should not be confused with the statistical "[[wikipedia:Standard score|Standard score]]". Here, it describes the propensity of a given sequence to adopt the left-handed form of DNA; it is simply a probability score.</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div><div style="float:left; margin:0px 20px 20px 0px;"></div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div><div style="float:left; margin:0px 20px 20px 0px;"></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>{| align="center" style="border: 1px solid #999; background-color:#FFFFFF"</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>{| align="center" style="border: 1px solid #999; background-color:#FFFFFF"</div></td></tr>
<tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l50" >Line 50:</td>
<td colspan="2" class="diff-lineno">Line 68:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>|}</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>|}</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div></div></div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div></div></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">==Keywords and abbreviations==</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">*Keywords: Z-DNA; Nuclear factor I; Transcription regulation; Thermogenomics</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">*Abbreviations: ZDR, potential Z-DNA regions; NFI, nuclear factor I; CSF, colony stimulating factor</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>==See also==</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>==See also==</div></td></tr>
</table>
Christoph
http://wiki.christophchamp.com/index.php?title=Z-Hunt&diff=5212&oldid=prev
Christoph at 06:18, 25 December 2008
2008-12-25T06:18:58Z
<p></p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;' lang='en'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 06:18, 25 December 2008</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l1" >Line 1:</td>
<td colspan="2" class="diff-lineno">Line 1:</td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>'''Z-Hunt''' <del class="diffchange diffchange-inline">(aka </del>'''ZHunt''') is an algorithm for predicting the propensity of DNA to flip from the B-form to the [[Z-DNA|Z-form]]. The original algorithm was written by [[Dr. P. Shing Ho Laboratory|Dr. P. Shing Ho]] in 1986<ref name=Ho86>Ho PS, Ellison MJ, Quigley GJ, Rich A (1986). A computer aided thermodynamic approach for predicting the formation of Z-DNA in naturally occurring sequences. ''EMBO J, 5(10):2737-2744''.</ref> and was later developed by Tracy Camp, [[Christoph Champ|P. Christoph Champ]], Sandor Maurice, and Jeffrey M. Vargason for genome-wide mapping of [[Z-DNA]] (with P. Shing Ho as the principal investigator)<ref>[[Christoph Champ|Champ PC]], Maurice S, Vargason JM, Camp T, Ho PS (2004). Distributions of Z-DNA and nuclear factor I in human chromosome 22: a model for coupled transcriptional regulation. ''Nucleic Acids Research, 32(22):6501-6510''.</ref>. Z-Hunt is available for use Online at [http://gac-web.cgrb.oregonstate.edu/zDNA/ ZHunt Online].</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">'''ZHUNT''' (aka </ins>'''Z-Hunt''' <ins class="diffchange diffchange-inline">or </ins>'''ZHunt''') is an algorithm for predicting the propensity of DNA to flip from the B-form to the [[Z-DNA|Z-form]]. The original algorithm was written by [[Dr. P. Shing Ho Laboratory|Dr. P. Shing Ho]] in 1986<ref name=Ho86>Ho PS, Ellison MJ, Quigley GJ, Rich A (1986). A computer aided thermodynamic approach for predicting the formation of Z-DNA in naturally occurring sequences. ''EMBO J, 5(10):2737-2744''.</ref> and was later developed by Tracy Camp, [[Christoph Champ|P. Christoph Champ]], Sandor Maurice, and Jeffrey M. Vargason for genome-wide mapping of [[Z-DNA]] (with P. Shing Ho as the principal investigator)<ref>[[Christoph Champ|Champ PC]], Maurice S, Vargason JM, Camp T, Ho PS (2004). Distributions of Z-DNA and nuclear factor I in human chromosome 22: a model for coupled transcriptional regulation. ''Nucleic Acids Research, 32(22):6501-6510''.</ref>. Z-Hunt is available for use Online at [http://gac-web.cgrb.oregonstate.edu/zDNA/ ZHunt Online].</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>==Z-score==</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>==Z-score==</div></td></tr>
<tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l62" >Line 62:</td>
<td colspan="2" class="diff-lineno">Line 62:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div><small><references/></small></div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div><small><references/></small></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>===Further reading===</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>===Further reading===</div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">*Ho PS (2008). "Thermogenomics: Thermodynamic-based approaches to genomic analyses of DNA structure". ''Methods, [Epub ahead of print]''. PMID: 18848994. {{doi|10.1016/j.ymeth.2008.09.007}}</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>*Ho PS (1994). The non-B-DNA structure of d(CA/TG)n does not differ from that of Z-DNA. ''Proc Natl Acad Sci USA, 91(20):9549-9553''.</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>*Ho PS (1994). The non-B-DNA structure of d(CA/TG)n does not differ from that of Z-DNA. ''Proc Natl Acad Sci USA, 91(20):9549-9553''.</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>*Schroth GP, Chou PJ, Ho PS (1992). Mapping Z-DNA in the human genome. Computer-aided mapping reveals a nonrandom distribution of potential Z-DNA-forming sequences in human genes. ''J Biol Chem, 267(17):11846-55''.</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>*Schroth GP, Chou PJ, Ho PS (1992). Mapping Z-DNA in the human genome. Computer-aided mapping reveals a nonrandom distribution of potential Z-DNA-forming sequences in human genes. ''J Biol Chem, 267(17):11846-55''.</div></td></tr>
</table>
Christoph
http://wiki.christophchamp.com/index.php?title=Z-Hunt&diff=4850&oldid=prev
Christoph at 10:09, 15 February 2008
2008-02-15T10:09:19Z
<p></p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;' lang='en'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 10:09, 15 February 2008</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l1" >Line 1:</td>
<td colspan="2" class="diff-lineno">Line 1:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>'''Z-Hunt''' (aka '''ZHunt''') is an algorithm for predicting the propensity of DNA to flip from the B-form to the [[Z-DNA|Z-form]]. The original algorithm was written by [[Dr. P. Shing Ho Laboratory|Dr. P. Shing Ho]] in 1986<ref name=Ho86>Ho PS, Ellison MJ, Quigley GJ, Rich A (1986). A computer aided thermodynamic approach for predicting the formation of Z-DNA in naturally occurring sequences. ''EMBO J, 5(10):2737-2744''.</ref> and was later developed by Tracy Camp, [[Christoph Champ|P. Christoph Champ]], Sandor Maurice, and Jeffrey M. Vargason for genome-wide mapping of [[Z-DNA]] (with P. Shing Ho as the principal investigator)<ref>[[Christoph Champ|Champ PC]], Maurice S, Vargason JM, Camp T, Ho PS (2004). Distributions of Z-DNA and nuclear factor I in human chromosome 22: a model for coupled transcriptional regulation. ''Nucleic Acids Research, 32(22):6501-6510''.</ref>. Z-Hunt is available for use Online at [http://gac-web.cgrb.oregonstate.edu/zDNA/ ZHunt Online].</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>'''Z-Hunt''' (aka '''ZHunt''') is an algorithm for predicting the propensity of DNA to flip from the B-form to the [[Z-DNA|Z-form]]. The original algorithm was written by [[Dr. P. Shing Ho Laboratory|Dr. P. Shing Ho]] in 1986<ref name=Ho86>Ho PS, Ellison MJ, Quigley GJ, Rich A (1986). A computer aided thermodynamic approach for predicting the formation of Z-DNA in naturally occurring sequences. ''EMBO J, 5(10):2737-2744''.</ref> and was later developed by Tracy Camp, [[Christoph Champ|P. Christoph Champ]], Sandor Maurice, and Jeffrey M. Vargason for genome-wide mapping of [[Z-DNA]] (with P. Shing Ho as the principal investigator)<ref>[[Christoph Champ|Champ PC]], Maurice S, Vargason JM, Camp T, Ho PS (2004). Distributions of Z-DNA and nuclear factor I in human chromosome 22: a model for coupled transcriptional regulation. ''Nucleic Acids Research, 32(22):6501-6510''.</ref>. Z-Hunt is available for use Online at [http://gac-web.cgrb.oregonstate.edu/zDNA/ ZHunt Online].</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>== Z-score ==</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>==Z-score==</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>Note: The following table is a list of test sequences with their corresponding conformational assignments and Z-scores.</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>Note: The following table is a list of test sequences with their corresponding conformational assignments and Z-scores<ins class="diffchange diffchange-inline">. This "Z-score" should not be confused with the statistical "[[wikipedia:Standard score|Standard score]]". Here, it describes the propensity of a given sequence to adopt the left-handed form of DNA; it is simply a probability score</ins>.</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div><div style="float:left; margin:0px 20px 20px 0px;"></div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div><div style="float:left; margin:0px 20px 20px 0px;"></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>{| align="center" style="border: 1px solid #999; background-color:#FFFFFF"</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>{| align="center" style="border: 1px solid #999; background-color:#FFFFFF"</div></td></tr>
<tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l51" >Line 51:</td>
<td colspan="2" class="diff-lineno">Line 51:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div></div></div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div></div></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>== See also ==</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>==See also==</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>* [[Z-DNA]]</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>*[[Z-DNA]]</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>* [<del class="diffchange diffchange-inline">http://en.</del>wikipedia<del class="diffchange diffchange-inline">.org/wiki/DNA_supercoil </del>DNA supercoil]</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>*[<ins class="diffchange diffchange-inline">[</ins>wikipedia<ins class="diffchange diffchange-inline">:</ins>DNA supercoil<ins class="diffchange diffchange-inline">]</ins>]</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>* [<del class="diffchange diffchange-inline">http://en.</del>wikipedia<del class="diffchange diffchange-inline">.org/wiki/Gibbs_free_energy </del>Gibbs free energy]</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>*[<ins class="diffchange diffchange-inline">[</ins>wikipedia<ins class="diffchange diffchange-inline">:</ins>Gibbs free energy<ins class="diffchange diffchange-inline">]</ins>]</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>* [<del class="diffchange diffchange-inline">http://en.</del>wikipedia<del class="diffchange diffchange-inline">.org/wiki/Topoisomerase </del>Topoisomerase]</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>*[<ins class="diffchange diffchange-inline">[</ins>wikipedia<ins class="diffchange diffchange-inline">:</ins>Topoisomerase<ins class="diffchange diffchange-inline">]</ins>]</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>* [<del class="diffchange diffchange-inline">http://en.</del>wikipedia<del class="diffchange diffchange-inline">.org/wiki/Linking_number </del>Linking number]</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>*[<ins class="diffchange diffchange-inline">[</ins>wikipedia<ins class="diffchange diffchange-inline">:</ins>Linking number<ins class="diffchange diffchange-inline">]</ins>]</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>* [<del class="diffchange diffchange-inline">http://en.</del>wikipedia<del class="diffchange diffchange-inline">.org/wiki/M%C3%B6bius_strip </del>Möbius strip]</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>*[<ins class="diffchange diffchange-inline">[</ins>wikipedia<ins class="diffchange diffchange-inline">:</ins>Möbius strip<ins class="diffchange diffchange-inline">]</ins>]</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>== References ==</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>==References==</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div><small><references/></small></div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div><small><references/></small></div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>=== Further reading ===</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>===Further reading===</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>* Ho PS (1994). The non-B-DNA structure of d(CA/TG)n does not differ from that of Z-DNA. ''Proc Natl Acad Sci USA, 91(20):9549-9553''.</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>*Ho PS (1994). The non-B-DNA structure of d(CA/TG)n does not differ from that of Z-DNA. ''Proc Natl Acad Sci USA, 91(20):9549-9553''.</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>* Schroth GP, Chou PJ, Ho PS (1992). Mapping Z-DNA in the human genome. Computer-aided mapping reveals a nonrandom distribution of potential Z-DNA-forming sequences in human genes. ''J Biol Chem, 267(17):11846-55''.</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>*Schroth GP, Chou PJ, Ho PS (1992). Mapping Z-DNA in the human genome. Computer-aided mapping reveals a nonrandom distribution of potential Z-DNA-forming sequences in human genes. ''J Biol Chem, 267(17):11846-55''.</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>==External links==</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>==External links==</div></td></tr>
</table>
Christoph
http://wiki.christophchamp.com/index.php?title=Z-Hunt&diff=4664&oldid=prev
Christoph: /* External links */
2007-09-30T03:46:52Z
<p><span dir="auto"><span class="autocomment">External links</span></span></p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;' lang='en'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 03:46, 30 September 2007</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l65" >Line 65:</td>
<td colspan="2" class="diff-lineno">Line 65:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>* Schroth GP, Chou PJ, Ho PS (1992). Mapping Z-DNA in the human genome. Computer-aided mapping reveals a nonrandom distribution of potential Z-DNA-forming sequences in human genes. ''J Biol Chem, 267(17):11846-55''.</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>* Schroth GP, Chou PJ, Ho PS (1992). Mapping Z-DNA in the human genome. Computer-aided mapping reveals a nonrandom distribution of potential Z-DNA-forming sequences in human genes. ''J Biol Chem, 267(17):11846-55''.</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>== External links ==</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>==External links==</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>* [http://gac-web.cgrb.oregonstate.edu/zDNA/ ZHunt Online Server] &mdash; front end by Sandor Maurice; back end by Sandor Maurice and P. Christoph Champ.</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>*[http://gac-web.cgrb.oregonstate.edu/zDNA/ ZHunt Online Server] &mdash; front end by Sandor Maurice; back end by Sandor Maurice and P. Christoph Champ.</div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">*[http://structure.usc.edu/make-na/ make-na server] &mdash; create custom DNA structures (in PDB format)</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>[[Category:Academic Research]]</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>[[Category:Academic Research]]</div></td></tr>
</table>
Christoph
http://wiki.christophchamp.com/index.php?title=Z-Hunt&diff=4617&oldid=prev
Christoph: /* Z-score */
2007-09-17T07:05:24Z
<p><span dir="auto"><span class="autocomment">Z-score</span></span></p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;' lang='en'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 07:05, 17 September 2007</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l46" >Line 46:</td>
<td colspan="2" class="diff-lineno">Line 46:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>ASASASASASASASASASASASAS    |</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>ASASASASASASASASASASASAS    |</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div></pre></div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div></pre></div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>|| Various test sequences are shown with their corresponding Z-score as assigned by Z-hunt [version 1]. Z-scores are defined as the number of random base pairs that must be scanned, on average, to find a sequence with equal or better Z-forming capacity relative to the sequence in question. The conformation selected by Z-hunt for each nucleotide (A for ''anti'' and S for ''syn'') are indicated below each sequence. Bases which deviate from perfect purine-pyrimidine alternation are designated by dots above that nucleotide. Discontinuities in the conformational phases produced by Z-Z junctions are represented by gaps separating the sequence.<ref name=Ho86>Ho PS, Ellison MJ, Quigley GJ, Rich A (1986). A computer aided thermodynamic approach for predicting the formation of Z-DNA in naturally occurring sequences. ''EMBO J, 5(10):2737-2744''.</ref></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>|<ins class="diffchange diffchange-inline">-</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>|Various test sequences are shown with their corresponding Z-score as assigned by Z-hunt [version 1]. Z-scores are defined as the number of random base pairs that must be scanned, on average, to find a sequence with equal or better Z-forming capacity relative to the sequence in question. The conformation selected by Z-hunt for each nucleotide (A for ''anti'' and S for ''syn'') are indicated below each sequence. Bases which deviate from perfect purine-pyrimidine alternation are designated by dots above that nucleotide. Discontinuities in the conformational phases produced by Z-Z junctions are represented by gaps separating the sequence.<ref name=Ho86>Ho PS, Ellison MJ, Quigley GJ, Rich A (1986). A computer aided thermodynamic approach for predicting the formation of Z-DNA in naturally occurring sequences. ''EMBO J, 5(10):2737-2744''.</ref></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>|}</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>|}</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div></div></div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div></div></div></td></tr>
</table>
Christoph
http://wiki.christophchamp.com/index.php?title=Z-Hunt&diff=2515&oldid=prev
Christoph: /* Z-score */
2006-08-09T00:00:59Z
<p><span dir="auto"><span class="autocomment">Z-score</span></span></p>
<table class='diff diff-contentalign-left'>
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;' lang='en'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 00:00, 9 August 2006</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l3" >Line 3:</td>
<td colspan="2" class="diff-lineno">Line 3:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>== Z-score ==</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>== Z-score ==</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Note: The following table is a list of test sequences with their corresponding conformational assignments and Z-scores.</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Note: The following table is a list of test sequences with their corresponding conformational assignments and Z-scores.</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;"><div style="float:left; margin:0px 20px 20px 0px;"></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">{| align="center" style="border: 1px solid #999; background-color:#FFFFFF"</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">|-align="center" bgcolor="#1188ee"</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">!Sequence/conformation assignments</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">!Z-score</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">|-</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">|<pre>CGCGCGCGCGCGCGCGCGCGCGCG</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">ASASASASASASASASASASASAS</pre></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">|| 2 x 10<sup>11</sup></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">|- bgcolor="#eee"</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">|<pre></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">CGCGCGCGCGCG</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">ASASASASASAS</pre></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">|| 4 x 10<sup>7</sup></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">|-</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">|<pre></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">CACACACACACACACACACACACA</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">ASASASASASASASASASASASAS</pre></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">|| 2 x 10<sup>5</sup></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">|- bgcolor="#eee"</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">|<pre></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">CACACACACACA</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">ASASASASASAS</pre></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">|| 2 x 10<sup>4</sup></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">|-</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">|<pre></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">CGCGCGCGCGCG GCGCGCGCGCGC</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">ASASASASASAS SASASASASASA</pre></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">|| 2 x 10<sup>8</sup></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">|- bgcolor="#eee"</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">|<pre></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">CGCGCG GCGCGC CGCGCG GCGCGC</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">ASASAS SASASA ASASAS SASASA</pre></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">|| 7 x 10<sup>4</sup></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">|-</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">|<pre></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;"> *  *  *  *  *  *</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">CCCGCCCGCCCGCCCGCCCGCCCG</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">ASASASASASASASASASASASAS</pre></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">|| 8 x 10<sup>4</sup></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">|- bgcolor="#eee"</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">|<pre></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">  *  *  *  *  *  *</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">CAGGCAGGCAGGCAGGCAGGCAGG</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">ASASASASASASASASASASASAS</pre></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">|| 1 x 10<sup>3</sup></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">|-</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">|<pre></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;"> * * * * * * * * * * * *</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">CCCCCCCCCCCCCCCCCCCCCCCC</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">ASASASASASASASASASASASAS</pre></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">|| 52</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">|- bgcolor="#eee"</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">|<pre></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">ATATATATATATATATATATATAT</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">SASASASASASASASASASASASA</pre></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">|| 38</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">|-</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">|<pre></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">AAAAAAAAAAAAAAAAAAAAAAAA</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">ASASASASASASASASASASASAS</pre></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">|| 3 x 10<sup>-7</sup></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">|}</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;"><div align="center">''Source: Ho, et al.<ref name=Ho86>Ho PS, Ellison MJ, Quigley GJ, Rich A (1986). A computer aided thermodynamic approach for predicting the formation of Z-DNA in naturally occurring sequences. ''EMBO J, 5(10):2737-2744''.</ref>''</div></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;"></div></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;"></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div><div style="float:left; margin:0px 20px 20px 0px;"></div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div><div style="float:left; margin:0px 20px 20px 0px;"></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>{| align="center" style="border: 1px solid #999; background-color:#FFFFFF"</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>{| align="center" style="border: 1px solid #999; background-color:#FFFFFF"</div></td></tr>
</table>
Christoph